-
Purposelentiviral expression of a stoichiometric F-actin and myosin light chain reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV-EF1a-IRES-Blast
- Backbone size w/o insert (bp) 8614
- Total vector size (bp) 10754
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtractin-mRuby3-P2A-mTurquoise-MLC
-
Insert Size (bp)2169
- Promoter EF1a
-
Tag
/ Fusion Protein
- mRuby3, mTurquoise
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer ACACCGGCCTTATTCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Stoichiometric expression of Ftractin-mRuby3 and mTurquiose-MLC is achieved through insertion of a ribosomal skipping sequence (P2A) between the two reporter sequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-Ftractin-mRuby3-p2A-mTurquoise-MLC-IRES-Blast was a gift from Tobias Meyer (Addgene plasmid # 85146 ; http://n2t.net/addgene:85146 ; RRID:Addgene_85146) -
For your References section:
Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A, Betzig E, Meyer T. Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14. 10.1038/ncb3438 PubMed 27842057