Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-RSV-SpCas9
(Plasmid #85450)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85450 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pRSV
  • Promoter pRSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGGTCTAGAaatgtagtcttatgcaatac
  • 3′ sequencing primer CGGACCGGTTTTATGTATCGAGCTAGGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We purchased a lentiviral vector with shRNA-MDM2 from GE Dharmacon (Lafayette, CO)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We replaced the pMecp2 promoter of SpCas9 (Addgene: 60957) with a RSV (Rous Sarcoma Virus) promoter, which was amplified from a lentiviral vector for shRNA-MDM2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-RSV-SpCas9 was a gift from Hetian Lei (Addgene plasmid # 85450 ; http://n2t.net/addgene:85450 ; RRID:Addgene_85450)
  • For your References section:

    The CRISPR/Cas9-created MDM2 T309G enhances vitreous-induced expression of MDM2 and proliferation and survival of cells. Duan Y, Ma G, Huang X, D'Amore PA, Zhang F, Lei H. J Biol Chem. 2016 May 31. pii: jbc.M116.729467. 10.1074/jbc.M116.729467 PubMed 27246850