This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85544)


Item Catalog # Description Quantity Price (USD)
Plasmid 85544 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pXMJ19 and pTRCmob
  • Vector type
    Bacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    crRNA of crtYf
  • gRNA/shRNA sequence
    crRNA: gaatttctactgttgtagatcaggcaaccatagggcaggaa
  • Species

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJYS2_crtYf was a gift from Sheng Yang (Addgene plasmid # 85544 ; ; RRID:Addgene_85544)
  • For your References section:

    CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Jiang Y, Qian F, Yang J, Liu Y, Dong F, Xu C, Sun B, Chen B, Xu X, Li Y, Wang R, Yang S. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. 10.1038/ncomms15179 PubMed 28469274