sgEML4
(Plasmid #85568)

• Purpose: Expresses sgRNA targeting human EML4 between exon 13 and 14
• Depositing Lab: Luca Grumolato
• Publication: Guernet et al Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.

Backbone

• Vector backbone: pSpCas9(BB)-2A-Puro (PX459)
• Backbone manufacturer: Feng Zhang
• Total vector size (bp): 9200
• Modifications to backbone: Insertion of a sgRNA sequence targeting EML4
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: echinoderm microtubule associated protein like 4
• gRNA/shRNA sequence: GACCTGAACAGCAAGTTTGT
• Species: H. sapiens (human)
• Entrez Gene: EML4 (a.k.a. C2orf2, ELP120, EMAP-4, EMAPL4, ROPP120)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA sequence from Choi and Meyerson (2014), Nat Commun 5, 3728