-
PurposecGAL driver (Prab-3::GAL4-SK(DBD)::VP64::let-858 3'UTR) construct for C. elegans using the S. kudriavzevii (SK) GAL4 DNA-binding domain (DBD)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPD117.01
-
Backbone manufacturerFire Lab C. elegans Vector Kit
- Backbone size w/o insert (bp) 2778
- Total vector size (bp) 4819
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePrab-3-GAL4-SK(DBD)-VP64
-
Insert Size (bp)2041
- Promoter Prab-3-GAL4-SK(DBD)-VP64
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer oHW10f TGAGCGGATAACAATTTCAC
- 3′ sequencing primer oHW233r cgaattgggagacggaaagag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHW393 (Prab-3::GAL4-SK(DBD)::VP64::let-858 3'UTR) was a gift from Paul Sternberg (Addgene plasmid # 85583 ; http://n2t.net/addgene:85583 ; RRID:Addgene_85583) -
For your References section:
cGAL, a temperature-robust GAL4-UAS system for Caenorhabditis elegans. Wang H, Liu J, Gharib S, Chai CM, Schwarz EM, Pokala N, Sternberg PW. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4109. 10.1038/nmeth.4109 PubMed 27992408