CMV epArcLight
(Plasmid
#85803)
-
Purposegenetically-encoded fluorescent voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+ CMV
- Backbone size w/o insert (bp) 5694
- Total vector size (bp) 7167
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameepArcLight
-
Alt nameCiVSD-ecliptic pHluorin
-
Alt nameCiSP
-
Alt nameecliptic pHluorin
-
SpeciesCiona intestinalis
-
MutationCi-VSP contains R217Q mutation; ecliptic pHluorin contains A227D mutation. The A227D mutation increases the fluorescence response magnitude.
-
GenBank IDAB183035 AF058695.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer tgcgtgtggttcgattagcaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV epArcLight was a gift from Vincent Pieribone (Addgene plasmid # 85803 ; http://n2t.net/addgene:85803 ; RRID:Addgene_85803) -
For your References section:
Directed evolution of key residues in fluorescent protein inverses the polarity of voltage sensitivity in the genetically-encoded indicator ArcLight. Platisa J, Vasan G, Yang A, Pieribone VA. ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234. 10.1021/acschemneuro.6b00234 PubMed 28045247