This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Human a4 nicotinic subunit crystallization construct
(Plasmid #85841)


Item Catalog # Description Quantity Price (USD)
Plasmid 85841 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Hibbs Lab
  • Total vector size (bp) 8657
  • Vector type
    Mammalian Expression ; Baculovirus (bacmam) production and mammalian expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Human a4 nAChR subunit crystallization construct
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ttgcctttctctccacaggt
  • 3′ sequencing primer catgatacaaaggcattaaag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human a4 nicotinic subunit crystallization construct was a gift from Ryan Hibbs (Addgene plasmid # 85841)
  • For your References section:

    X-ray structure of the human alpha4beta2 nicotinic receptor. Morales-Perez CL, Noviello CM, Hibbs RE. Nature. 2016 Oct 3;538(7625):411-415. doi: 10.1038/nature19785. 10.1038/nature19785 PubMed 27698419