pQhsCDtRNA+
(Plasmid #86014)

• Purpose: Multi-gene expression system for purification of human box C/D RNPs with U14-tRNA minigene
• Depositing Lab: Hong Li
• Publication: Peng et al PLoS One. 2014 Jul 31;9(7):e103096. doi: 10.1371/journal.pone.0103096. eCollection 2014.

Backbone

• Vector backbone: pQLinkN (Addgene #13670)
• Backbone manufacturer: Konrad Buessow lab
• Vector type: Bacterial Expression ; Co-Expression; Purification

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: U14-tRNA chimera
• Species: H. sapiens (human)
• Entrez Gene: SNORD14A (a.k.a. RNU14, RNU14A, U14, U14-S13-5)
• Promoter: LPP

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG

Gene/Insert 2

• Gene/Insert name: 15.5K
• Species: H. sapiens (human)
• Entrez Gene: SNU13 (a.k.a. 15.5K, FA-1, FA1, NHP2L1, NHPX, OTK27, SNRNP15-5, SPAG12, SSFA1)
• Promoter: Ptac

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: Unknown

Gene/Insert 3

• Gene/Insert name: fibrillarin
• Species: H. sapiens (human)
• Mutation: amino acids 83-316
• Entrez Gene: FBL (a.k.a. FIB, FLRN, Nop1, RNU3IP1)
• Promoter: Ptac

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: Unknown

Gene/Insert 4

• Gene/Insert name: NOP56
• Species: H. sapiens (human)
• Mutation: amino acids 1-411
• Entrez Gene: NOP56 (a.k.a. NOL5A, SCA36)
• Promoter: Ptac
• Tag / Fusion Protein:
  • 6x-His (C terminal on insert)

Cloning Information for Gene/Insert 4

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: Unknown

Gene/Insert 5

• Gene/Insert name: NOP58
• Species: H. sapiens (human)
• Mutation: amino acids 1-401
• Entrez Gene: NOP58 (a.k.a. HSPC120, NOP5, NOP5/NOP58)
• Promoter: Ptac

Cloning Information for Gene/Insert 5

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see associated publication for additional graphics describing this plasmid.

Plasmid construction: To construct the human box C/D RNP plasmid, pQhsCDtRNA+, pQLinkN (Addgene #13670) was inserted with the coding sequences of Homo sapiens (Hs) NOP56 (amino acids 1 to 411), NOP58 (amino acids 1 to 401) and fibrillarin (amino acids 83 to 316), 15.5 K, and U14 snoRNA. Each protein-encoding gene was first cloned into pQLink-N plasmid using BamHI and NotI sites. The plasmids containing two different protein-encoding genes were then digested by SwaI and PacI, respectively, treated with LIC qualified T4 polymerase (dCTP for Pac I digest and dGTP for Swa I digest) and then annealed at 70°C. Each clone was identified by digestion of the recombined plasmid with Pac I. This process was repeated for additional coding sequence until all were inserted.
To construct the tRNA-RNA chimera, the DNA sequence of human U14 snoRNA was fused with that of E. coli initiator tRNAMet scaffold under the control of lpp promoter. The fused mini gene sequences contain the Xho I site, the LINK1 sequence (required for pQLink-N fusion), the lpp promoter, tRNA scaffold part I, sR3 sRNA/U14 snoRNA, tRNA scaffold part II, the rrnC terminator and the Hind III site. The Xho I and Hind III sites were used to clone the mini gene into the pQLink-N vector. Finally, the tRNA-sRNA/snoRNA segment was recombined with box C/D protein coding sequences via the LINK reaction of the pQLink system resulting in pQhsCDtRNA+. In addition, a plasmid containing all protein-encoding sequences without an inserted RNA mini gene, pQhsCD, were also constructed.