pCMV-mFlagEts1
(Plasmid #86099)

• Purpose: expresses flag tagged Ets1 in mammalian cells
• Depositing Lab: Barbara Graves
• Publication: Seidel et al Genes Dev. 2002 Jan 1;16(1):127-37.

Backbone

• Vector backbone: pCMV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 7500
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ets1
• Species: M. musculus (mouse)
• Insert Size (bp): 2296
• GenBank ID: BC010588 BC010588
• Entrez Gene: Ets1 (a.k.a. D230050P06, Ets-1, Tpl1, p54, vs)
• Tag / Fusion Protein:
  • Flag tag; kanamycin selection

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nsi1 (unknown if destroyed)
• 3′ cloning site: Apa1 (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry