pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
(Plasmid #86195)

• Purpose: U6 based expression of N meningitidis sgRNA
• Depositing Lab: Scot Wolfe
• Publication: Amrani et al Genome Biol. 2018 Dec 5;19(1):214. doi: 10.1186/s13059-018-1591-1.

Backbone

• Vector backbone: pLKO.1
• Total vector size (bp): 9023
• Modifications to backbone: Contains NmCas9 sgRNA expression cassette with BfuAI sites for cloning guide RNAs into the cassette
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nmCas9 sgRNA cloning cassete
• gRNA/shRNA sequence: BfuAI cloning cassette
• Species: N. meningitidis
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age! (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTGACGTAGAAAGTAATAATTTC
• 3′ sequencing primer: CCTCGAGCCGCGGCCAAAG

Resource Information

• Supplemental Documents:
  • pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer.txt
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry