Flag-nls-NgAgo-GK
(Plasmid #86435)

• Purpose: Expresses a Flag tag on the N-terminal
• Depositing Lab: Gaétan Burgio
• Publication: Khin et al PLoS One. 2017 Jun 13;12(6):e0178768. doi: 10.1371/journal.pone.0178768. eCollection 2017.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 6748
• Modifications to backbone: pEGFP-N1 without the eGFP
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NgAgo
• Alt name: Argonaute
• Species: Natronobacterium gregoryi
• Insert Size (bp): 2948
• GenBank ID: FORO00000000.1 AFZ73749.1
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AleI (destroyed during cloning)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: CMV_promoter_SF GTGTACGGTGGGAGGTCTAT
• 3′ sequencing primer: NgAgo_SR TACGACGAGCAGCCACAATA

Resource Information

• Supplemental Documents:
  • Flag-nls-NgAgo-GK.gb
• A portion of this plasmid was derived from a plasmid made by: We modified the nls-NgAgo-GK (78253)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry