pGL4.23-MYC
(Plasmid #86461)

• Purpose: (Empty Backbone) A modified version of the Promega pGL4.23 vector. Contains the MYC promoter in place of the minimal promoter and polyadenylation signals flanking the enhancer cloning site.
• Depositing Lab: Eric Lander
• Publication: Fulco et al Science. 2016 Sep 29. pii: aag2445.

Backbone

• Vector backbone: pGL4.23
• Backbone manufacturer: Promega
• Backbone size (bp): 4500
• Vector type: Mammalian Expression, Luciferase
• Promoter: MYC

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: RVprimer3 CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: L4440 AGCGAGTCAGTGAGCGAG

Resource Information

• Supplemental Documents:
  • Annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use FspI and AclI to remove the kanamycin resistance cassette and replace with putative regulatory elements by Gibson cloning.