Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pU6-gRNA-TAZ
(Plasmid #86688)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86688 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR-Blunt-II
  • Backbone manufacturer
    Life Technologies
  • Modifications to backbone
    Inserted gBlock containing U6 promoter and TAZ gRNA
  • Vector type
    CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6-gRNA-TAZ
  • gRNA/shRNA sequence
    GAAGCTCAACCATGGGGACT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_000116
  • Entrez Gene
    TAFAZZIN (a.k.a. BTHS, CMD3A, EFE, EFE2, G4.5, LVNCX, TAZ, Taz1)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-gRNA-TAZ was a gift from William Pu (Addgene plasmid # 86688 ; http://n2t.net/addgene:86688 ; RRID:Addgene_86688)
  • For your References section:

    Efficient, footprint-free human iPSC genome editing by consolidation of Cas9/CRISPR and piggyBac technologies. Wang G, Yang L, Grishin D, Rios X, Ye LY, Hu Y, Li K, Zhang D, Church GM, Pu WT. Nat Protoc. 2017 Jan;12(1):88-103. doi: 10.1038/nprot.2016.152. Epub 2016 Dec 8. 10.1038/nprot.2016.152 PubMed 27929521