pMRXIP SECFP-Stx17TM
(Plasmid
#86777)
-
PurposeExpresses transmembrane domains of syntaxin17 tagged with SECFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMRXIP SECFP-Ci2
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 6822
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametransmembrane domains of human Syntaxin 17
-
SpeciesH. sapiens (human)
-
Insert Size (bp)222
-
GenBank IDNM_017919.2
-
Entrez GeneSTX17
-
Tag
/ Fusion Protein
- SECFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAAGACGGCAATATGGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP SECFP-Stx17TM was a gift from Noboru Mizushima (Addgene plasmid # 86777 ; http://n2t.net/addgene:86777 ; RRID:Addgene_86777) -
For your References section:
The hairpin-type tail-anchored SNARE syntaxin 17 targets to autophagosomes for fusion with endosomes/lysosomes. Itakura E, Kishi-Itakura C, Mizushima N. Cell. 2012 Dec 7;151(6):1256-69. doi: 10.1016/j.cell.2012.11.001. 10.1016/j.cell.2012.11.001 PubMed 23217709