Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pUB-Cas9-@GL1
(Plasmid #86779)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86779 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUB-Cas9
  • Backbone manufacturer
    Hahn et al., 2017
  • Backbone size w/o insert (bp) 14121
  • Total vector size (bp) 14834
  • Modifications to backbone
    Introduction of U6-26p::sgRNA
  • Vector type
    Plant Expression, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA against GLABROUS1
  • Species
    Synthetic
  • Insert Size (bp)
    735
  • Promoter Arabidopsis U6-26 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtaaaacgacggccag
  • 3′ sequencing primer TATTACTGACTCGTCGGGTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Peter Hegemann (HU Berlin)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Generates mutations in GLABROUS1 gene, resulting in trichomeless Arabidopsis leaf phenotype (see Hahn et al., 2017)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB-Cas9-@GL1 was a gift from Andreas Weber (Addgene plasmid # 86779 ; http://n2t.net/addgene:86779 ; RRID:Addgene_86779)
  • For your References section:

    An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. 10.3389/fpls.2017.00039 PubMed 28174584