Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP-C1-AR V7
(Plasmid #86856)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86856 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech (Takara)
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 6642
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Sequence-verify the poly-glutamine expansion when preparing new plasmid preps.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Androgen receptor (AR)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1932
  • Mutation
    Alternative splice variant 7 (alteration/deletion of the C-terminus)
  • GenBank ID
    NM_000044.3
  • Entrez Gene
    AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xma I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Prostate. 2013 February 15; 73(3): 267–277. doi:10.1002/pros.22566. The activity of the androgen receptor variant AR-V7 is regulated
by FOXO1 in a PTEN-PI3K-AKT-dependent way.

Cloning is described in the supplemental materials (excerpted below).

Cloning Strategy
The carboxy-terminal part of AR-V7 and AR-V1 were PCR amplified by using the following primers: sense (common for AR-V1 and AR-V7 amplification) 5’-GCGCAAGCTTCTGGGTGTCACTATGGAGC (harboring a Hind III site), antisense for AR-V7 GCTCTAGATCAGGGTCTGGTCATTTTGAGATGC (harboring a XbaI site), antisense for AR-V1 GCTCTAGATTAAGGAAGCCATTCTGAGACTCC (also harboring a XbaI site). CMV-AR-V7 and CMV-AR-V1 were generated by replacing a HindIII-XbaI cDNA fragment encoding the carboxy-terminal portion of wild-type AR (subcloned into a pcDNA3 plasmid) with the AR-V7 or AR-V1 fragments generated by PCR. GFP-AR-V7 and GFP-AR-V1 were generated by replacing an XmaI-XbaI cDNA fragment encoding the carboxy-terminal part of wild-type AR, subcloned in frame to the green fluorescent protein of plasmid pEGFP-c1, with XmaI-XbaI fragments from the pcDNA3 plasmids containing the AR-V7 and AR-V1 variants.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-AR V7 was a gift from Michael Mancini & Marco Marcelli (Addgene plasmid # 86856 ; http://n2t.net/addgene:86856 ; RRID:Addgene_86856)
  • For your References section:

    High-Content Screening Identifies Src Family Kinases as Potential Regulators of AR-V7 Expression and Androgen-Independent Cell Growth. Szafran AT, Stephan C, Bolt M, Mancini MG, Marcelli M, Mancini MA. Prostate. 2017 Jan;77(1):82-93. doi: 10.1002/pros.23251. Epub 2016 Oct 4. 10.1002/pros.23251 PubMed 27699828