pChuk
(Plasmid
#87033)
-
Purposeexpress IKKalpha in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepeGFP
- Total vector size (bp) 6938
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIKKalpha
-
SpeciesM. musculus (mouse)
-
Entrez GeneChuk (a.k.a. AI256658, Chuk1, Fbx24, Fbxo24, IKBKA, IKK alpha, IKK1, Ikka, NFKBIKA)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGGGCGGCCCCCGGGGCTGCGGC
- 3′ sequencing primer TCATTCTGCTAACCAACTCCAATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pChuk was a gift from Georgios Stathopoulos (Addgene plasmid # 87033 ; http://n2t.net/addgene:87033 ; RRID:Addgene_87033) -
For your References section:
Myeloid-derived interleukin-1beta drives oncogenic KRAS-NF-kappaBeta addiction in malignant pleural effusion. Marazioti A, Lilis I, Vreka M, Apostolopoulou H, Kalogeropoulou A, Giopanou I, Giotopoulou GA, Krontira AC, Iliopoulou M, Kanellakis NI, Agalioti T, Giannou AD, Jones-Paris C, Iwakura Y, Kardamakis D, Blackwell TS, Taraviras S, Spella M, Stathopoulos GT. Nat Commun. 2018 Feb 14;9(1):672. doi: 10.1038/s41467-018-03051-z. 10.1038/s41467-018-03051-z PubMed 29445180