Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJOP-HTT-HR18Q
(Plasmid #87228)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87228 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PBHR100A-1
  • Backbone manufacturer
    SBI System Biosciences
  • Total vector size (bp) 12069
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1.7kb HTT 5' homology arm, 2.5kb HTT 3' homology arm
  • Species
    H. sapiens (human)
  • Promoter EF1a driving selection cassette

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI/NotI (unknown if destroyed)
  • 3′ cloning site BspQI (destroyed)/SpeI (unknown if destroyed)
  • 5′ sequencing primer GTTTCGCCACCTCTGACTTG
  • 3′ sequencing primer TCATTTTGACTCACGCGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJOP-HTT-HR18Q was a gift from Mahmoud Pouladi (Addgene plasmid # 87228 ; http://n2t.net/addgene:87228 ; RRID:Addgene_87228)
  • For your References section:

    Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells. Xu X, Tay Y, Sim B, Yoon SI, Huang Y, Ooi J, Utami KH, Ziaei A, Ng B, Radulescu C, Low D, Ng AY, Loh M, Venkatesh B, Ginhoux F, Augustine GJ, Pouladi MA. Stem Cell Reports. 2017 Feb 21. pii: S2213-6711(17)30038-3. doi: 10.1016/j.stemcr.2017.01.022. 10.1016/j.stemcr.2017.01.022 PubMed 28238795