Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ACA8-YFPn
(Plasmid #87241)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87241 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAMPAT-35S
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ACA8
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    ACA8 (a.k.a. AT5G57110, ''AUTOINHIBITED CA2+ -ATPASE, ''autoinhibited Ca2+ -ATPase, 'autoinhibited Ca2+ -ATPase, AT-ACA8, AUTOINHIBITED CA2+ -ATPASE, ISOFORM 8, ISOFORM 8'', MUL3.5, MUL3_5, autoinhibited Ca2+ -ATPase, isoform 8, isoform 8', isoform 8'')
  • Promoter 35s
  • Tag / Fusion Protein
    • YFPn (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGACGCACAATCCCACTATCCTTCGCA
  • 3′ sequencing primer CATTTGGAGAAGGACCTCGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACA8-YFPn was a gift from Silke Robatzek (Addgene plasmid # 87241 ; http://n2t.net/addgene:87241 ; RRID:Addgene_87241)
  • For your References section:

    Plasma membrane calcium ATPases are important components of receptor-mediated signaling in plant immune responses and development. Frei dit Frey N, Mbengue M, Kwaaitaal M, Nitsch L, Altenbach D, Haweker H, Lozano-Duran R, Njo MF, Beeckman T, Huettel B, Borst JW, Panstruga R, Robatzek S. Plant Physiol. 2012 Jun;159(2):798-809. doi: 10.1104/pp.111.192575. Epub 2012 Apr 25. 10.1104/pp.111.192575 PubMed 22535420