Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGBKT7-BUD13
(Plasmid #87547)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87547 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGBKT7
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7300
  • Total vector size (bp) 8079
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BUD13
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    814
  • GenBank ID
    NP_011341.3
  • Entrez Gene
    BUD13 (a.k.a. YGL174W, CWC26)
  • Tags / Fusion Proteins
    • GAL4 BD (N terminal on backbone)
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cctgcatatggcattgcatcagtatttatc
  • 3′ sequencing primer gggatgtcctcctaataactcctagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGBKT7-BUD13 was a gift from Aaron Hoskins (Addgene plasmid # 87547 ; http://n2t.net/addgene:87547 ; RRID:Addgene_87547)
  • For your References section:

    SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast. Carrocci TJ, Zoerner DM, Paulson JC, Hoskins AA. Nucleic Acids Res. 2017 Jan 6. pii: gkw1349. doi: 10.1093/nar/gkw1349. 10.1093/nar/gkw1349 PubMed 28062854