Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PGC-1 alpha promoter 2kb luciferase
(Plasmid #8887)


Item Catalog # Description Quantity Price (USD)
Plasmid 8887 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4818
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    PGC-1 alpha promoter
  • Alt name
    PGC1 promoter
  • Alt name
    PGC-1a promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Ppargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
  • 3′ sequencing primer GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

5' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PGC-1 alpha promoter 2kb luciferase was a gift from Bruce Spiegelman (Addgene plasmid # 8887 ; ; RRID:Addgene_8887)
  • For your References section:

    An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM. Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6. 10.1073/pnas.1232352100 PubMed 12764228