pAPM sh1 DNMT1
(Plasmid
#88884)
-
PurposeLentiviral vector expressing shRNA against murine DNMT1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 88884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAPM
- Backbone size w/o insert (bp) 7505
- Total vector size (bp) 7616
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA no.1 DNMT1
-
gRNA/shRNA sequenceAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCACAAACGCTCTCATCGACAAGT GAGTGTGTGAGGGAGAAAACTTGTCGATGAGAGCGTTTGTATGCCTACTGCCTCGGAATT CAAGGGGCT
-
SpeciesM. musculus (mouse)
- Promoter SFFV (spleen focus forming virus)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGTTTATTACAGGGACAGCAGAG
- 3′ sequencing primer CCACCGGTATCGATACGCGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAPM sh1 DNMT1 was a gift from Silvia Monticelli (Addgene plasmid # 88884 ; http://n2t.net/addgene:88884 ; RRID:Addgene_88884) -
For your References section:
Dnmt3a restrains mast cell inflammatory responses. Leoni C, Montagner S, Rinaldi A, Bertoni F, Polletti S, Balestrieri C, Monticelli S. Proc Natl Acad Sci U S A. 2017 Feb 6. pii: 201616420. doi: 10.1073/pnas.1616420114. 10.1073/pnas.1616420114 PubMed 28167789