GFP-Rab27A
(Plasmid #89237)

• Purpose: Expression of GFP-tagged human Rab27A in mammalian cells
• Depositing Lab: William Gahl
• Publication: Westbroek et al Mol Genet Metab. 2008 Jun;94(2):248-54. doi: 10.1016/j.ymgme.2008.02.009. Epub 2008 Apr 7.

Backbone

• Vector backbone: peGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5360
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Rab27A
• Species: H. sapiens (human)
• Insert Size (bp): 660
• Mutation: wild type
• GenBank ID: BC132800.1
• Entrez Gene: RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
• Promoter: CMV
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5’: CATGGTCCTGCTGGAGTTCGTGACCG
• 3′ sequencing primer: 5’: ATAAGCTGCAATAAACAAGTTAACAA

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry