Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pOD2046-bwmDEG
(Plasmid #89367)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89367 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCFJ151
  • Backbone manufacturer
    Christian Frøkjær-Jensen (Erik Jorgensen lab)
  • Backbone size w/o insert (bp) 7328
  • Total vector size (bp) 13587
  • Vector type
    Targeting vector for Mos1 transposon mediated single copy transgene insertion
  • Selectable markers
    Cb-unc-119(+)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vhhGFP4-ZIF-1
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    2098
  • Entrez Gene
    zif-1 (a.k.a. CELE_F59B2.6)
  • Promoter Pmyo-3
  • Tag / Fusion Protein
    • vhhGFP4 (GFP nanobody) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtaaaacgacggccagt
  • 3′ sequencing primer CGACTCACTAGTGGGCAGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOD2046-bwmDEG was a gift from Karen Oegema (Addgene plasmid # 89367 ; http://n2t.net/addgene:89367 ; RRID:Addgene_89367)
  • For your References section:

    A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Wang S, Tang NH, Lara-Gonzalez P, Zhao Z, Cheerambathur DK, Prevo B, Chisholm AD, Desai A, Oegema K. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. 10.1242/dev.150094 PubMed 28619826