Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-sgRNA(MS2)-puro-barcode
(Plasmid #89493)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89493 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plenti
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 8401
  • Modifications to backbone
    The sgRNA and Cas9 gene were replaced with sgRNA(MS2) backbone and an barcode insertion region was introduced between WPRE and 3'LTR.
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Only amplify in recombinase deficient bacteria (eg. Stbl3 or HST08).
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA (with MS2 loop)
  • Alt name
    lentiGuide Barcode
  • gRNA/shRNA sequence
    empty backbone
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCTTGTGGAAAGGACGAAACACCGGAGACGGGATACC
  • 3′ sequencing primer ctcaagatctagttacgccaagcttAAAAAAgcaccgact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgRNA(MS2)-puro-barcode was a gift from Gary Hon (Addgene plasmid # 89493 ; http://n2t.net/addgene:89493 ; RRID:Addgene_89493)
  • For your References section:

    Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells. Xie S, Duan J, Li B, Zhou P, Hon GC. Mol Cell. 2017 Apr 20;66(2):285-299.e5. doi: 10.1016/j.molcel.2017.03.007. Epub 2017 Apr 13. 10.1016/j.molcel.2017.03.007 PubMed 28416141