Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89720)


Item Catalog # Description Quantity Price (USD)
Plasmid 89720 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang lab, modified by Boris Greber lab
  • Backbone size w/o insert (bp) 10827
  • Total vector size (bp) 10830
  • Modifications to backbone
    1. Puromycin resistance-2A-GFP cassette (previously introduced by Boris Greber lab) 2. IRF8 gRNA2
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    IRF8 gRNA2
  • gRNA/shRNA sequence
    human IRF8 locus (Intron 2 - Exon 3 boundary)
  • Species
    H. sapiens (human)
  • GenBank ID
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer actatcatatgcttaccgtaac
  • 3′ sequencing primer aacgccaatagggactttcc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Original vector from Feng Zhang lab (pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Plasmid #42335) was modified from Boris Greber lab with a Puromycin resistance-2A-GFP cassette (Zhang M, D'Aniello C, Verkerk AO et al. Recessive cardiac phenotypes in induced pluripotent stem cell models of Jervell and Lange-Nielsen syndrome: disease mechanisms and pharmacological rescue. Proc Natl Acad Sci USA 2014;111:E5383-E5392.).
This backbone was used for IRF8 gRNA cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335A_hCas9(D10A)_IRF8gRNA2 was a gift from Martin Zenke (Addgene plasmid # 89720 ; ; RRID:Addgene_89720)
  • For your References section:

    Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Sontag S, Forster M, Qin J, Wanek P, Mitzka S, Schuler HM, Koschmieder S, Rose-John S, Sere K, Zenke M. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565. 10.1002/stem.2565 PubMed 28090699