T7-PseB-His6
(Plasmid
#89723)
-
PurposeExpresses PseB from C. jejuni with an N-terminal T7 tag and a C-terminal His6 tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET24a(+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5310
- Total vector size (bp) 6315
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePseB
-
SpeciesCampylobacter jejuni
-
Insert Size (bp)1005
-
GenBank ID905585
-
Tag
/ Fusion Protein
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer ATGTTTAACAAAAAAAATATCTTAATCACGGGCGG
- 3′ sequencing primer TTAAAAACCTTCAGTATGATTGATGATTTCTAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-PseB-His6 was a gift from Barbara Imperiali (Addgene plasmid # 89723 ; http://n2t.net/addgene:89723 ; RRID:Addgene_89723) -
For your References section:
Chemoenzymatic Synthesis and Applications of Prokaryote-Specific UDP-Sugars. Zamora CY, Schocker NS, Chang MM, Imperiali B. Methods Enzymol. 2017;597:145-186. doi: 10.1016/bs.mie.2017.06.003. Epub 2017 Jul 5. 10.1016/bs.mie.2017.06.003 PubMed 28935101
