pMT2 Alpha2 delta-1 V6
(Plasmid #89894)

• Purpose: Mammalian expression of Alpha2 delta-1 V6
• Depositing Lab: Annette Dolphin
• Publication: Kadurin et al Elife. 2016 Oct 26;5. pii: e21143. doi: 10.7554/eLife.21143.

Backbone

• Vector backbone: pMT2
• Backbone size w/o insert (bp): 5129
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cacna2d1
• Alt name: Alpha2delta-1
• Species: R. norvegicus (rat)
• Mutation: Amino acids L943V, E944V, A945V, E947V, M948V are mutated.
• Entrez Gene: Cacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
• Promoter: adenovirus major late promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: 5' agcttgaggtgtggcaggctt 3'
• 3′ sequencing primer: 5' ggtcgaaccatgatggcagc 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5 amino acids are mutated to valines in the region believe to be involved in post translational cleavage of the alpha2 and delta-1 moities (there is already a Valine at AA position 946) leading to a stretch of 6 valines