This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89921)


Item Catalog # Description Quantity Price (USD)
Plasmid 89921 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATTAATGCAGCTGGCAC
  • 3′ sequencing primer GGTTATTGTCTCATGAGCGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Addgene's sequencing results found that this vector is larger than other BB2 vectors. The depositing lab confirmed that, since the vector contains FS E and FS F sites, it should be functional for cloning purposes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BB2_L_EF_syn_BbsI was a gift from Michael Sauer (Addgene plasmid # 89921 ; ; RRID:Addgene_89921)
  • For your References section:

    An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066