pCMV sMTase (eGFP)
(Plasmid
#89930)
-
PurposeExpresses sMTase system for targeted DNA methylation in mammalian cells. Contains an eGFP marker expressed off separate promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4156
- Total vector size (bp) 10312
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB 10-beta or ER2267
-
Growth instructionsRequires strain that is tolerant of CpG methylation
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-MC-IRES-MN
-
Alt nameNLS-Flag-dCas9-lfl-M.SssI[273-386]-NLS - IRES - NLS-HA-M.SssI[2-272]
-
Insert Size (bp)6156
-
Mutationdeactivated Cas9
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGTACGGTGGGAGG
- 3′ sequencing primer gcttgccaaacctacaggtgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV sMTase (eGFP) was a gift from Carl Novina (Addgene plasmid # 89930 ; http://n2t.net/addgene:89930 ; RRID:Addgene_89930) -
For your References section:
Targeted DNA methylation in human cells using engineered dCas9-methyltransferases. Xiong T, Meister GE, Workman RE, Kato NC, Spellberg MJ, Turker F, Timp W, Ostermeier M, Novina CD. Sci Rep. 2017 Jul 27;7(1):6732. doi: 10.1038/s41598-017-06757-0. 10.1038/s41598-017-06757-0 [pii] PubMed 28751638