Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKDsgRNA-rpsL
(Plasmid #89953)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89953 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKD46
  • Total vector size (bp) 6959
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    rpsL gRNA
  • gRNA/shRNA sequence
    AGCGCGGAGTTCGGTTTTTT
  • Promoter pTet

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKDsgRNA-rpsL was a gift from Michael Lynch (Addgene plasmid # 89953 ; http://n2t.net/addgene:89953 ; RRID:Addgene_89953)
  • For your References section:

    Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. Moreb EA, Hoover B, Yaseen A, Valyasevi N, Roecker Z, Menacho-Melgar R, Lynch MD. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. 10.1021/acssynbio.7b00174 PubMed 28915012