Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)
(Plasmid #90086)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90086 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Addgene
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Synthetic
  • GenBank ID
    301447
  • Promoter EFS
  • Tags / Fusion Proteins
    • Destabilized Domain (N terminal on insert)
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATTATCTAGAGCCACCATGGGAGTGCAGGTGGAAACCATCTCCCCAGGTGACG GGCGCACCTTCCCCAAGCGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE) was a gift from Raffaella Sordella (Addgene plasmid # 90086 ; http://n2t.net/addgene:90086 ; RRID:Addgene_90086)
  • For your References section:

    Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Senturk S, Shirole NH, Nowak DG, Corbo V, Pal D, Vaughan A, Tuveson DA, Trotman LC, Kinney JB, Sordella R. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370. 10.1038/ncomms14370 PubMed 28224990