LP346
(Plasmid #90175)

• Purpose: pEGFP-C1 with cDNA encoding HsKIF13B aa residues 1-1000
• Depositing Lab: Lotte Pedersen
• Publication: Schou et al Nat Commun. 2017 Jan 30;8:14177. doi: 10.1038/ncomms14177.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 7700
• Modifications to backbone: None
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KIF13B
• Alt name: GAKIN
• Species: H. sapiens (human)
• Insert Size (bp): 3000
• Mutation: aa residues 1-1000
• GenBank ID: NM_015254.3
• Entrez Gene: KIF13B (a.k.a. GAKIN)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: EGFP-C: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert PCR-amplified from plasmid received from Dr. Athar Chishti, Tufts University School of Medicine (pEGFP-C1 with full-length GAKIN/KIF13B; Asaba et al. J. Biol. Chem. 2003, PMID: 12496241).

Addgene's sequencing results found a D813Y mutation in KIF13B compared to the reference sequence NM_015254.3. This residue is not conserved in kinesin-3 motors and is unlikely to affect plasmid function.