Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLO99
(Plasmid #90219)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90219 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR-BluntII Topo
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Aspergillus

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATET_03691
  • Species
    Aspergillus terreus NIH 2624
  • Promoter pLac

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert sequence contains flanking sequences not from the Aspergillus terreus genome that were added to facilitate cloning. These sequences are caatgctcttcaccctcttc and agtgcctcctctcagacag. For more information, please see the attached supplemental file.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLO99 was a gift from Berl Oakley (Addgene plasmid # 90219 ; http://n2t.net/addgene:90219 ; RRID:Addgene_90219)
  • For your References section:

    New multi-marker strains and complementing genes for Aspergillus nidulans molecular biology. Dohn JW Jr, Grubbs AW, Oakley CE, Oakley BR. Fungal Genet Biol. 2018 Feb;111:1-6. doi: 10.1016/j.fgb.2018.01.003. Epub 2018 Jan 5. 10.1016/j.fgb.2018.01.003 PubMed 29309843