Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCAS_gpyrG2
(Plasmid #90277)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90277 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BB3_AMA_2.8_pUC-ORI_L_AC_hph
  • Backbone size w/o insert (bp) 5997
  • Total vector size (bp) 14715
  • Vector type
    Bacterial Expression ; A. niger

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA (pyrg2)
  • gRNA/shRNA sequence
    GTAGGTCAATTGCGACTTGG
  • Species
    A. niger

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAS_gpyrG2 was a gift from Michael Sauer (Addgene plasmid # 90277 ; http://n2t.net/addgene:90277 ; RRID:Addgene_90277)
  • For your References section:

    An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066