pSH1
(Plasmid
#90295)
-
PurposeExpresses the fat-7 gene in C. elegans intestine
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep4P1R
-
Backbone manufacturerFrederick Mann, Kim Lab
- Backbone size w/o insert (bp) 4463
- Total vector size (bp) 6239
-
Modifications to backboneThis p4P1R vector already contains a 2kb insert of ges-1 promoter.
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefat-7
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1776
-
Entrez Genefat-7 (a.k.a. CELE_F10D2.9)
- Promoter ges-1
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGACGGTAAAAACTCGCGC
- 3′ sequencing primer TTACATGATCGATTTTTTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH1 was a gift from Anne Brunet (Addgene plasmid # 90295 ; http://n2t.net/addgene:90295 ; RRID:Addgene_90295) -
For your References section:
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan. Han S, Schroeder EA, Silva-Garcia CG, Hebestreit K, Mair WB, Brunet A. Nature. 2017 Apr 13;544(7649):185-190. doi: 10.1038/nature21686. Epub 2017 Apr 5. 10.1038/nature21686 PubMed 28379943