pCZGY546
(Plasmid #90466)

• Purpose: Pmec-4::mcherry, Expresses mcherry red fluorescence in C. elegans touch neurons
• Depositing Lab: Andrew Chisholm
• Publication: Xu et al Sci Rep. 2016 Feb 10;6:21271. doi: 10.1038/srep21271.

Backbone

• Vector backbone: Gateway Final LR Clone
• Total vector size (bp): 4847
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Pmec-4-mcherry
• Species: C. elegans (nematode), Synthetic
• GenBank ID:
• Promoter: Pmec-4
• Tag / Fusion Protein:
  • mcherry

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CAATTCATCCATGCCACCTGTC
• 3′ sequencing primer: caggaaacagctatgaccatg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Originally made by Dong Yan while he was a member of the Jin lab, a joint lab with the Chisholm lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry