pCZGY546
(Plasmid
#90466)
-
PurposePmec-4::mcherry, Expresses mcherry red fluorescence in C. elegans touch neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneGateway Final LR Clone
- Total vector size (bp) 4847
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePmec-4-mcherry
-
SpeciesC. elegans (nematode), Synthetic
-
GenBank ID
- Promoter Pmec-4
-
Tag
/ Fusion Protein
- mcherry
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAATTCATCCATGCCACCTGTC
- 3′ sequencing primer caggaaacagctatgaccatg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginally made by Dong Yan while he was a member of the Jin lab, a joint lab with the Chisholm lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY546 was a gift from Andrew Chisholm (Addgene plasmid # 90466 ; http://n2t.net/addgene:90466 ; RRID:Addgene_90466) -
For your References section:
Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG. Xu S, Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. doi: 10.1038/srep21271. 10.1038/srep21271 PubMed 26861262