|
Plasmid
9062:
pMIG small T H42Q
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Hahn et al (Mol Cell Biol 2002 Apr;22(7):2111-23. PubMed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 9062" in your Materials and Methods section. |
A retrovirus encoding the SV40 small t (ST) oncoprotein was constructed by amplifying the ST sequences by PCR using the oligonucleotides B5ST (5' GGCGGATCCGCCACCATGGATAAAGTTTT 3') and E3ST (5'AGGCGAATTCTTAGAGCTTTAAATCTCTG 3'). The resulting fragment was sequenced and introduced into pMIG. H42Q mutant.