1
Plasmid 9065: pBABE-zeo small T H42Q
  • SV40 small T Antigen

  • 520

  • simian virus

  • SV40gp7 (SV40gp7)

  • pBABE-zeo
    (Search Vector Database)

  • Mammalian Expression, Retroviral

  • 4800

  • BamHI

  • No

  • EcoRI

  • No

  • pBABE 5' List of Sequencing Primers

  • pBABE 3'

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Zeocin

  • View sequences (1)
  • Bob Weinberg

  • MTA

Comments: 

A retrovirus encoding the SV40 small t (ST) oncoprotein was constructed by amplifying the ST sequences by PCR using the vector pVU- (30) and the oligonucleotides B5ST (5' GGCGGATCCGCCACCATGGATAAAGTTTT 3') and E3ST (5'AGGCGAATTCTTAGAGCTTTAAATCTCTG 3'). The resulting fragment was sequenced and introduced into pMIG (pMIG-ST) (81) and pBABE-zeo. H42Q mutant.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Hahn et al (Mol Cell Biol 2002 Apr;22(7):2111-23. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 9065" in your Materials and Methods section.