-
PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1-2A-NptII with sgRNA targeting SlEtr
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZD_OsU3gYSA_HolgerCas9_NPTII
- Backbone size w/o insert (bp) 17766
-
Modifications to backboneCas9(D10A) mutation was introduced. IV2 intron was inserted at 5' of Cas9.
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9
-
SpeciesStreptococcus pyogenes
-
MutationD10A for nickase Cas9
- Promoter PcUbi
-
Tag
/ Fusion Protein
- PmCDA1 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGCATAGATCTGGATTACATG
- 3′ sequencing primer GGTCTTGACAAAAAGAACCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDicAID_nCas9-PmCDA-2A-NptII_ETR was a gift from Akihiko Kondo (Addgene plasmid # 91695 ; http://n2t.net/addgene:91695 ; RRID:Addgene_91695) -
For your References section:
Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Shimatani Z, Kashojiya S, Takayama M, Terada R, Arazoe T, Ishii H, Teramura H, Yamamoto T, Komatsu H, Miura K, Ezura H, Nishida K, Ariizumi T, Kondo A. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833. 10.1038/nbt.3833 PubMed 28346401