pLIX-REST
(Plasmid #91896)

• Purpose: Doxycycline inducible expression of mouse REST
• Depositing Lab: Julien Sage
• Publication: MIG-REST (unpublished)

Backbone

• Vector backbone: pLIX_403
• Backbone manufacturer: David Root lab
• Backbone size w/o insert (bp): 9396
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: REST
• Alt name: NRSF
• Alt name: RE1-Silencing Transcription Factor
• Alt name: Neuron-Restrictive Silencer Factor
• Species: M. musculus (mouse)
• Insert Size (bp): 3660
• GenBank ID: NM_011263
• Entrez Gene: Rest (a.k.a. 2610008J04Rik, NRSF, REST4)
• Promoter: TRE promoter, Tet ON

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: LNCX
• 3′ sequencing primer: O.PGK1b-R (GAACGGACGTGAAGAATGTG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: REST/NRSF insert DNA obtained from Addgene 21310, pHR'-NRSF-CITE-GFP

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry