Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #92110)


Item Catalog # Description Quantity Price (USD)
Plasmid 92110 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pX330-like (without U6-sgRNA coding sequence)
  • Total vector size (bp) 8077
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
  • Alt name
  • Species
    S. pyogenes
  • Insert Size (bp)
  • Mutation
    R661A, Q695A, K848A, Q926A, K1003A, R1060A
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAGGGATGGTTGGTTGGTGG
  • 3′ sequencing primer GGAAAGGACAGTGGGAGTGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

pCbh-3xFLAG-NLS-HeFm1SpCas9-NLS (without U6-sgRNA coding sequence).

Highly enhanced Fidelity nuclease variant HeFm1SpCas9 contains mutations from both eSpCas9 (1.1) and SpCas9-HF1.

HeFSpCas9s exhibits activity with spectacularly increased specificity specifically for those targets that are met with higher off-target propensity by eSpCas9 (1.1) and SpCas9-HF1.

The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).

For detailed information and plasmid usage, please see the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HeFm1SpCas9 was a gift from Ervin Welker (Addgene plasmid # 92110 ; ; RRID:Addgene_92110)
  • For your References section:

    Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Kulcsar PI, Talas A, Huszar K, Ligeti Z, Toth E, Weinhardt N, Fodor E, Welker E. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. 10.1186/s13059-017-1318-8 [pii] PubMed 28985763