Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pZac2.1 hSynapsin1 FLEX NAPA-N SV40
(Plasmid #92283)


Item Catalog # Description Quantity Price (USD)
Plasmid 92283 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Neuron-astrocyte proximity assay - Neuronal
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter hSynapsin1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACCATCTGCGCTGCGGCG
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAAT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 hSynapsin1 FLEX NAPA-N SV40 was a gift from Baljit Khakh (Addgene plasmid # 92283 ; ; RRID:Addgene_92283)
  • For your References section:

    An Optical Neuron-Astrocyte Proximity Assay at Synaptic Distance Scales. J. Christopher Octeau, Hua Chai, Ruotian Jiang, Shivan L. Bonanno, Kelsey C. Martin, Baljit S. Khakh. Neuron (Volume 98, Issue 1, p49–66) 10.1016/j.neuron.2018.03.003