pHdzCas9-KRAB
(Plasmid
#92341)
-
Purpose(Empty Backbone) Expression dzCas9-KRAB in microalgae. CRISPR/Cas based plant genome editing and gene regulation, Hyg resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHdzCas9-KRAB
-
Backbone manufacturerAddgene
- Backbone size (bp) 11169
-
Vector typePlant Expression, CRISPR ; Plant expression
- Promoter CaMV35S
-
Selectable markersHygromycin
-
Tag
/ Fusion Protein
- KRAB (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ATGGATTACAAGGACCACGACGGGGA
- 3′ sequencing primer TACGATGTCCCTGACTACGCCTCATGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHdzCas9-KRAB was a gift from I-Son Ng (Addgene plasmid # 92341 ; http://n2t.net/addgene:92341 ; RRID:Addgene_92341) -
For your References section:
CRISPRi mediated phosphoenolpyruvate carboxylase regulation to enhance the production of lipid in Chlamydomonas reinhardtii. Kao PH, Ng IS. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30619-3. doi: 10.1016/j.biortech.2017.04.111. 10.1016/j.biortech.2017.04.111 PubMed 28501380