Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pIKU801-CrPEPC1
(Plasmid #92342)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92342 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSI103
  • Backbone manufacturer
    Chlamydomonas Resource Center
  • Backbone size w/o insert (bp) 4671
  • Total vector size (bp) 4691
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    paromomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-CrPEPC1
  • Alt name
    CrPEPC1
  • gRNA/shRNA sequence
    ggacgcggtgaccacctacc
  • Species
    Synthetic; Chlamydomonas reinhardtii
  • GenBank ID
    AY517644
  • Promoter AtU6-26

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCTCGAGCGACTTGCCTTCCGCACAATAC
  • 3′ sequencing primer GCAGTTCCGATGAGATAAACCAATAGAATTCAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIKU801-CrPEPC1 was a gift from I-Son Ng (Addgene plasmid # 92342 ; http://n2t.net/addgene:92342 ; RRID:Addgene_92342)
  • For your References section:

    CRISPRi mediated phosphoenolpyruvate carboxylase regulation to enhance the production of lipid in Chlamydomonas reinhardtii. Kao PH, Ng IS. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30619-3. doi: 10.1016/j.biortech.2017.04.111. 10.1016/j.biortech.2017.04.111 PubMed 28501380