pIKU801-CrPEPC1
(Plasmid
#92342)
-
PurposeExpresses sgRNA for targeting CrPEPC1 gene, paromomycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 92342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSI103
-
Backbone manufacturerChlamydomonas Resource Center
- Backbone size w/o insert (bp) 4671
- Total vector size (bp) 4691
-
Vector typePlant Expression, CRISPR
-
Selectable markersparomomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-CrPEPC1
-
Alt nameCrPEPC1
-
gRNA/shRNA sequenceggacgcggtgaccacctacc
-
SpeciesSynthetic; Chlamydomonas reinhardtii
-
GenBank IDAY517644
- Promoter AtU6-26
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCTCGAGCGACTTGCCTTCCGCACAATAC
- 3′ sequencing primer GCAGTTCCGATGAGATAAACCAATAGAATTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIKU801-CrPEPC1 was a gift from I-Son Ng (Addgene plasmid # 92342 ; http://n2t.net/addgene:92342 ; RRID:Addgene_92342) -
For your References section:
CRISPRi mediated phosphoenolpyruvate carboxylase regulation to enhance the production of lipid in Chlamydomonas reinhardtii. Kao PH, Ng IS. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30619-3. doi: 10.1016/j.biortech.2017.04.111. 10.1016/j.biortech.2017.04.111 PubMed 28501380