Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAG Cas9-2A-Citrine
(Plasmid #92358)


Item Catalog # Description Quantity Price (USD)
Plasmid 92358 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4944
  • Total vector size (bp) 9886
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Cas9 2A Citrine
  • Insert Size (bp)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTAACCATGTTCATGCCTTC
  • 3′ sequencing primer CTGAGGAGTGAATTGCGGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cas9_2A_Citrine was amplified from pTK Cas9_2A_Citrine (Williams et al 2017) and inserted into pCI_H2B_RFP (Betancur 2010) digested with Not1 and Nhe1 to remove IRES_H2B_RFP
  • Terms and Licenses

Depositor Comments

Betancur, P., M. Bronner-Fraser, and T. Sauka-Spengler. 2010. Genomic code for Sox10 activation reveals a key regulatory enhancer for cranial neural crest. Proc Natl Acad Sci U S A. 107:3570-3575.

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG Cas9-2A-Citrine was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92358 ; ; RRID:Addgene_92358)
  • For your References section:

    Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245