Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX330a dCas9-KRAB
(Plasmid #92361)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92361 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    x330
  • Backbone size w/o insert (bp) 4332
  • Total vector size (bp) 8731
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-KRAB
  • Insert Size (bp)
    4399
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tctgactgaccgcgttactc
  • 3′ sequencing primer aggaaaggacagtgggagtg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cas9m4-VP64 was amplified from (Addgene #47319) and cloned into pX330 (Addgene #42230). VP64 was then removed by EcoRI digest and KRAB was inserted by In-fusion of a synthetic gBlock containing the KRAB sequence into the EcoRI-linearised pX330 vector.
  • Terms and Licenses

Depositor Comments

CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. 10.1038/nbt.2675 PubMed 23907171

Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718

Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Thakore PI, D'Ippolito AM, Song L, Safi A, Shivakumar NK, Kabadi AM, Reddy TE, Crawford GE, Gersbach CA. Nat Methods. 2015 Dec;12(12):1143-9. doi: 10.1038/nmeth.3630. Epub 2015 Oct 26. 10.1038/nmeth.3630 PubMed 26501517

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330a dCas9-KRAB was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92361 ; http://n2t.net/addgene:92361 ; RRID:Addgene_92361)
  • For your References section:

    Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245