pCAG dCas9-KRAB-2A-EGFP
(Plasmid #92396)

• Purpose: CAG-driven ubiquitous expression of catalytically inactive Cas9 fused to KRAB repressor domain. Contains 2A-EGFP reporter. For targeted enhancer inactivation in chicken embryos.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Williams et al Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333.

Backbone

• Vector backbone: pCAGG
• Backbone size w/o insert (bp): 4951
• Total vector size (bp): 10183
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9_KRAB_2A_EGFP
• Insert Size (bp): 5232
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTGCTGGTTATTGTGCTGT
• 3′ sequencing primer: CCAGCCACCACCTTCTGATA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dCas9-KRAB-2A-GFP was amplified from pLV hUbC dCas9 KRAB T2A GFP (Addgene #71237) and cloned into the pCI-H2B-RFP vector linearised with NotI and XhoI.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Thakore PI, D'Ippolito AM, Song L, Safi A, Shivakumar NK, Kabadi AM, Reddy TE, Crawford GE, Gersbach CA. Nat Methods. 2015 Dec;12(12):1143-9. doi: 10.1038/nmeth.3630. Epub 2015 Oct 26. 10.1038/nmeth.3630 PubMed 26501517

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.