-
PurposeExpression of VAMP3 C-terminally conjugated to mCherry.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmCherry-N1
-
Backbone manufacturerCloneTech
-
Modifications to backbonenone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVAMP3
-
Alt nameVAMP3, cellubrevin
-
SpeciesM. musculus (mouse)
-
GenBank IDNP_033524.1
-
Entrez GeneVamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer CACCTTGAAGCGCATGAACT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP3-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 92423 ; http://n2t.net/addgene:92423 ; RRID:Addgene_92423) -
For your References section:
Fluorescence lifetime imaging microscopy reveals rerouting of SNARE trafficking driving dendritic cell activation. Verboogen DRJ, Gonzalez Mancha N, Ter Beest M, van den Bogaart G. Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525. 10.7554/eLife.23525 PubMed 28524818