Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

VAMP3-mCherry
(Plasmid #92423)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92423 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-N1
  • Backbone manufacturer
    CloneTech
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VAMP3
  • Alt name
    VAMP3, cellubrevin
  • Species
    M. musculus (mouse)
  • GenBank ID
    NP_033524.1
  • Entrez Gene
    Vamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer CACCTTGAAGCGCATGAACT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VAMP3-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 92423 ; http://n2t.net/addgene:92423 ; RRID:Addgene_92423)
  • For your References section:

    Fluorescence lifetime imaging microscopy reveals rerouting of SNARE trafficking driving dendritic cell activation. Verboogen DRJ, Gonzalez Mancha N, Ter Beest M, van den Bogaart G. Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525. 10.7554/eLife.23525 PubMed 28524818