Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSpCas9(BB)-2A-Puro-Exon4-PAFAH1B1
(Plasmid #92433)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92433 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) v2.0
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PAFAH1B1
  • gRNA/shRNA sequence
    CAC CGGCATATTTTTCTGGCGGACG
  • Species
    H. sapiens (human)
  • Entrez Gene
    PAFAH1B1 (a.k.a. LIS1, LIS2, MDCR, MDS, NudF, PAFAH)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-Puro-Exon4-PAFAH1B1 was a gift from Ralf Brandes & Matthias Leisegang (Addgene plasmid # 92433 ; http://n2t.net/addgene:92433 ; RRID:Addgene_92433)
  • For your References section:

    PAFAH1B1 and the lncRNA NONHSAT073641 maintain an angiogenic phenotype in human endothelial cells. Josipovic I, Fork C, Preussner J, Prior KK, Iloska D, Vasconez AE, Labocha S, Angioni C, Thomas D, Ferreiros N, Looso M, Pullamsetti SS, Geisslinger G, Steinhilber D, Brandes RP, Leisegang MS. Acta Physiol (Oxf). 2016 Apr 28. doi: 10.1111/apha.12700. 10.1111/apha.12700 PubMed 27124368